Mature sequence osa-miR1440a

Accession numberMIMAT0005990
IDosa-miR1440a
Previous IDsosa-miR1440
Stem-Loop osa-MIR1440a
Sequence
ugcucaaauaccacucuccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).