Mature sequence osa-miR1437a

Accession numberMIMAT0005988
IDosa-miR1437a
Previous IDsosa-miR1437
Stem-Loop osa-MIR1437a
Sequence
uccggcgccgcacuaggcacug
Get sequence
Deep sequencing2 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).