Mature sequence osa-miR810b.2

Accession numberMIMAT0005978
IDosa-miR810b.2
Stem-Loop osa-MIR810b
Sequence
aagugauuuaauuaugccguu
Get sequence
Deep sequencing1 reads, 1 experiments
Database links
QuickGO function

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
2
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).