Mature sequence osa-miR444b.2

Accession numberMIMAT0005968
IDosa-miR444b.2
Stem-Loop osa-MIR444b
Sequence
ugcaguuguugucucaagcuu
Get sequence
Deep sequencing3660 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).