Mature sequence hsa-miR-1307-3p

Accession numberMIMAT0005951
IDhsa-miR-1307-3p
Previous IDshsa-miR-1307
Stem-Loop hsa-mir-1307
Sequence
acucggcguggcgucggucgug
Get sequence
Deep sequencing52303 reads, 159 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).