Mature sequence hsa-miR-1276

Accession numberMIMAT0005930
IDhsa-miR-1276
Stem-Loop hsa-mir-1276
Sequence
uaaagagcccuguggagaca
Get sequence
Deep sequencing814 reads, 68 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).