Mature sequence hsa-miR-1270

Accession numberMIMAT0005924
IDhsa-miR-1270
Stem-Loop hsa-mir-1270 hsa-mir-1270-2
Sequence
cuggagauauggaagagcugugu
Get sequence
Deep sequencing5962 reads, 103 experiments

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).