Mature sequence hsa-miR-1269a

Accession numberMIMAT0005923
IDhsa-miR-1269a
Previous IDshsa-miR-1269
Stem-Loop hsa-mir-1269a
Sequence
cuggacugagccgugcuacugg
Get sequence
Deep sequencing19842 reads, 80 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).