Mature sequence hsa-miR-1267

Accession numberMIMAT0005921
IDhsa-miR-1267
Stem-Loop hsa-mir-1267
Sequence
ccuguugaaguguaaucccca
Get sequence
Deep sequencing47 reads, 30 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).