Mature sequence hsa-miR-548o-3p

• Accession number: MIMAT0005919
• ID: hsa-miR-548o-3p
• Previous IDs: hsa-miR-548o
• Stem-Loop: hsa-mir-548o hsa-mir-548o-2
• Sequence: ccaaaacugcaguuacuuuugc
• Deep sequencing: 5269 reads, 130 experiments
• Database links:
  • RNAcentral:URS0000080D0A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-548o-3p
  • TargetScanVert:hsa-miR-548o-3p
  • miRDB:hsa-miR-548o-3p
  • microrna.org:hsa-miR-548o-3p

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).