Mature sequence hsa-miR-548g-3p

Accession numberMIMAT0005912
IDhsa-miR-548g-3p
Previous IDshsa-miR-548g
Stem-Loop hsa-mir-548g
Sequence
aaaacuguaauuacuuuuguac
Get sequence
Deep sequencing419 reads, 56 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).