Mature sequence hsa-miR-1258

Accession numberMIMAT0005909
IDhsa-miR-1258
Stem-Loop hsa-mir-1258
Sequence
aguuaggauuaggucguggaa
Get sequence
Deep sequencing561 reads, 54 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).