Mature sequence hsa-miR-1253

Accession numberMIMAT0005904
IDhsa-miR-1253
Stem-Loop hsa-mir-1253
Sequence
agagaagaagaucagccugca
Get sequence
Deep sequencing11 reads, 3 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).