Mature sequence hsa-miR-1305

Accession numberMIMAT0005893
IDhsa-miR-1305
Stem-Loop hsa-mir-1305
Sequence
uuuucaacucuaaugggagaga
Get sequence
Deep sequencing392 reads, 49 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).