Mature sequence hsa-miR-1295a

Accession numberMIMAT0005885
IDhsa-miR-1295a
Previous IDshsa-miR-1295
Stem-Loop hsa-mir-1295a
Sequence
uuaggccgcagaucuggguga
Get sequence
Deep sequencing972 reads, 91 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).