Mature sequence hsa-miR-1200

Accession numberMIMAT0005863
IDhsa-miR-1200
Stem-Loop hsa-mir-1200
Sequence
cuccugagccauucugagccuc
Get sequence
Deep sequencing6 reads, 5 experiments
Predicted targets

References

1
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).