Mature sequence hsa-miR-1179

Accession numberMIMAT0005824
IDhsa-miR-1179
Stem-Loop hsa-mir-1179
Sequence
aagcauucuuucauugguugg
Get sequence
Deep sequencing1106 reads, 103 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).