Mature sequence hsa-miR-320c

Accession numberMIMAT0005793
IDhsa-miR-320c
Stem-Loop hsa-mir-320c-1 hsa-mir-320c-2
Sequence
aaaagcuggguugagagggu
Get sequence
Deep sequencing2828473 reads, 159 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).