Mature sequence hsa-miR-513b-5p

Accession numberMIMAT0005788
IDhsa-miR-513b-5p
Stem-Loop hsa-mir-513b
Sequence
uucacaaggaggugucauuuau
Get sequence
Deep sequencing2827 reads, 59 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).