Accession | MIMAT0005516 |
Description | dme-miR-252-5p mature miRNA |
Hairpins | |
Sequence | CUAAGUACUAGUGCCGCAGGAG |
Evidence |
experimental
454 [1-2], Illumina [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0045824 negative regulation of innate immune response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:35100390 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29543534 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29543534 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30582233 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:35100390 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:36847222 | |
involved_in | GO:0001920 negative regulation of receptor recycling |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36847222 | |
involved_in | GO:0010972 negative regulation of G2/M transition of mitotic cell cycle |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29543534 | |
involved_in | GO:0032926 negative regulation of activin receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:35100390 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29543534 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30582233 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36847222 | |
involved_in | GO:0048640 negative regulation of developmental growth |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30582233 |