Mature dme-miR-964-5p
| Accession | MIMAT0005478 |
| Description | dme-miR-964-5p mature miRNA |
| Hairpins | |
| Sequence | UUAGAAUAGGGGAGCUUAACUU |
| Evidence |
experimental
454 [1-2], Illumina [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28823799 | |
| involved_in | GO:0002789 negative regulation of antifungal peptide production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28823799 | |
| involved_in | GO:0006955 immune response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23122660 | |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28823799 | |
| involved_in | GO:0060259 regulation of feeding behavior |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23122660 |
