Accession | MIMAT0005469 |
Description | dme-miR-956-3p mature miRNA |
Hairpins | |
Sequence | UUUCGAGACCACUCUAAUCCAUU |
Evidence |
experimental
454 [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27960110 | |
involved_in | GO:0050688 regulation of defense response to virus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27960110 |