Accession | MIMAT0005448 |
Description | mmu-miR-467b-5p mature miRNA |
Hairpins | |
Sequence | GUAAGUGCCUGCAUGUAUAUG |
Evidence |
experimental
MPSS [1], Illumina [2-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21986524 | has_input UniProtKB:P11152 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22963823 | has_input UniProtKB:P11152 |
involved_in | GO:0031670 cellular response to nutrient |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21986524 | occurs_in UBERON:0002107 |
involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22963823 | occurs_in CL:0000235 |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22963823 | occurs_in CL:0000235 |
involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22963823 | occurs_in CL:0000235 |
involved_in | GO:0033137 negative regulation of peptidyl-serine phosphorylation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21986524 | has_input UniProtKB:P35569 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21986524 | has_input UniProtKB:P11152 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22963823 | has_input UniProtKB:P11152 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22963823 | occurs_in CL:0000235 |
involved_in | GO:0071398 cellular response to fatty acid |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21986524 | |
involved_in | GO:1900131 negative regulation of lipid binding |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22963823 | occurs_in CL:0000235 |
involved_in | GO:2000342 negative regulation of chemokine (C-X-C motif) ligand 2 production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22963823 | occurs_in CL:0000235 |