Mature sequence tae-miR1135

Accession numberMIMAT0005370
IDtae-miR1135
Stem-Loop tae-MIR1135
Sequence
cugcgacaaguaauuccgaacgga
Get sequence
Deep sequencing266422 reads, 116 experiments

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).