Mature sequence rno-miR-434-3p

Accession numberMIMAT0005315
IDrno-miR-434-3p
Previous IDsrno-miR-434
Stem-Loop rno-mir-434-1 rno-mir-434-2
Sequence
uuugaaccaucacucgacuccu
Get sequence
Deep sequencing10066396 reads, 486 experiments

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).