Mature sequence cel-miR-1018

Accession numberMIMAT0005031
IDcel-miR-1018
Stem-Loop cel-mir-1018
Sequence
agagagaucauuggacuuacag
Get sequence
Deep sequencing2722 reads, 16 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).
2