Mature sequence dme-miR-1015-3p

Accession numberMIMAT0005028
IDdme-miR-1015-3p
Previous IDsdme-miR-1015
Stem-Loop dme-mir-1015
Sequence
uccugggacaucucucuugcag
Get sequence
Deep sequencing2212 reads, 40 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).