Mature sequence dme-miR-1013-3p

Accession numberMIMAT0005026
IDdme-miR-1013-3p
Previous IDsdme-miR-1013
Stem-Loop dme-mir-1013
Sequence
auaaaaguaugccgaacucg
Get sequence
Deep sequencing2363 reads, 49 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).