Mature sequence dme-miR-1009-3p

Accession numberMIMAT0005022
IDdme-miR-1009-3p
Previous IDsdme-miR-1009
Stem-Loop dme-mir-1009
Sequence
ucucaaaaauuguuacauuucag
Get sequence
Deep sequencing2082 reads, 48 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).