Mature sequence dme-miR-1004-3p

Accession numberMIMAT0005017
IDdme-miR-1004-3p
Previous IDsdme-miR-1004
Stem-Loop dme-mir-1004
Sequence
ucucacaucacuucccucacag
Get sequence
Deep sequencing1739 reads, 32 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).