Mature sequence dme-miR-1003-3p

Accession numberMIMAT0005016
IDdme-miR-1003-3p
Previous IDsdme-miR-1003
Stem-Loop dme-mir-1003
Sequence
ucucacauuuacauauucacag
Get sequence
Deep sequencing14718 reads, 49 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).