Mature sequence hsa-miR-943

Accession numberMIMAT0004986
IDhsa-miR-943
Stem-Loop hsa-mir-943
Sequence
cugacuguugccguccuccag
Get sequence
Deep sequencing70 reads, 41 experiments
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).