Accession | MIMAT0004950 |
Description | hsa-miR-877-3p mature miRNA |
Hairpins | |
Sequence | UCCUCUUCUCCCUCCUCCCAG |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27542871 | occurs_in CL:0000650 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27542871 | has_input UniProtKB:P01584 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27542871 | has_input UniProtKB:P01584 |