Mature sequence mmu-miR-511-5p

Accession numberMIMAT0004940
IDmmu-miR-511-5p
Previous IDsmmu-miR-511
Stem-Loop mmu-mir-511
Sequence
augccuuuugcucugcacuca
Get sequence
Deep sequencing271 reads, 50 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).