Accession | MIMAT0004939 |
Description | mmu-miR-208b-3p mature miRNA |
Hairpins | |
Sequence | AUAAGACGAACAAAAGGUUUGU |
Evidence |
experimental
cloned [2], 454 [3], Illumina [4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19922871 | has_input UniProtKB:P40645 |
involved_in | GO:0014883 transition between fast and slow fiber |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:19922871 | occurs_in UBERON:0001389 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19726871 | has_input UniProtKB:Q5SWW4 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19922871 | has_input UniProtKB:P40645 |