Mature sequence hsa-miR-541-3p

Accession numberMIMAT0004920
IDhsa-miR-541-3p
Previous IDshsa-miR-541
Stem-Loop hsa-mir-541
Sequence
uggugggcacagaaucuggacu
Get sequence
Deep sequencing262 reads, 33 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).