Mature sequence hsa-miR-892b

Accession numberMIMAT0004918
IDhsa-miR-892b
Stem-Loop hsa-mir-892b
Sequence
cacuggcuccuuucuggguaga
Get sequence
Deep sequencing47 reads, 26 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).