Mature sequence hsa-miR-890

Accession numberMIMAT0004912
IDhsa-miR-890
Stem-Loop hsa-mir-890
Sequence
uacuuggaaaggcaucaguug
Get sequence
Deep sequencing97 reads, 37 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).