Mature hsa-miR-874-3p

• Accession: MIMAT0004911
• Description: hsa-miR-874-3p mature miRNA
• Hairpins:
  • hsa-mir-874
• Sequence: CUGCCCUGGCCCGAGGGACCGA
• Evidence: experimental ; cloned [1-2], Illumina [3]

QuickGo Function

QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.

Qualifier	GO term	Evidence	Reference	Annotation Extension
acts_upstream_of	GO:1904046 negative regulation of vascular endothelial growth factor production	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:25596740	has_input UniProtKB:P15692
enables	GO:1903231 mRNA base-pairing translational repressor activity	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:25596740	has_input UniProtKB:P40763
involved_in	GO:0035278 miRNA-mediated gene silencing by inhibition of translation	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:25596740	has_input UniProtKB:P40763
involved_in	GO:1904893 negative regulation of receptor signaling pathway via STAT	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:25596740	has_input UniProtKB:P40763
located_in	GO:0005615 extracellular space	ECO:0007005 high throughput direct assay evidence used in manual assertion	PMID:26646931	part_of UBERON:0001969