Mature mmu-miR-15a-3p
| Accession | MIMAT0004624 |
| Description | mmu-miR-15a-3p mature miRNA |
| Hairpins | |
| Sequence | CAGGCCAUACUGUGCUGCCUCA |
| Evidence |
experimental
cloned [5], Illumina [6-7] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0045930 negative regulation of mitotic cell cycle |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21778430 | occurs_in CL:0000746 |
