Mature hsa-miR-149-3p
| Accession | MIMAT0004609 |
| Description | hsa-miR-149-3p mature miRNA |
| Hairpins | |
| Sequence | AGGGAGGGACGGGGGCUGUGC |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23595570 | |
| acts_upstream_of | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | |
| acts_upstream_of | GO:1903588 negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | occurs_in CL:0002618 |
| acts_upstream_of | GO:2000545 negative regulation of endothelial cell chemotaxis to fibroblast growth factor |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P09038 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23595570 | has_input UniProtKB:P05231 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P11362 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P35052 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28260877 | has_input UniProtKB:O00206 |
| involved_in | GO:0034144 negative regulation of toll-like receptor 4 signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28260877 | occurs_in CL:2000001 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23595570 | has_input UniProtKB:P05231 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P11362 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P35052 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29029439 | has_input UniProtKB:P40763 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28260877 | has_input UniProtKB:O00206 |
| involved_in | GO:0040037 negative regulation of fibroblast growth factor receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | occurs_in CL:0002544 |
| involved_in | GO:0044344 cellular response to fibroblast growth factor stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P09038 |
| involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0002107 |
| involved_in | GO:0071354 cellular response to interleukin-6 |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29029439 | |
| involved_in | GO:1904893 negative regulation of receptor signaling pathway via STAT |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29029439 |
