Mature sequence mmu-miR-193a-5p

Accession numberMIMAT0004544
IDmmu-miR-193a-5p
Previous IDsmmu-miR-193*;mmu-miR-193-5p
Stem-Loop mmu-mir-193a
Sequence
ugggucuuugcgggcaagauga
Get sequence
Deep sequencing9498 reads, 90 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).