Mature sequence hsa-miR-19a-5p

• Accession number: MIMAT0004490
• ID: hsa-miR-19a-5p
• Previous IDs: hsa-miR-19a*
• Stem-Loop: hsa-mir-19a
• Sequence: aguuuugcauaguugcacuaca
• Deep sequencing: 4992 reads, 58 experiments
• Database links:
  • RNAcentral:URS00001754CF_9606
• Predicted targets:
  • TargetMiner:hsa-miR-19a-5p
  • TargetScanVert:hsa-miR-19a-5p
  • miRDB:hsa-miR-19a-5p
  • microrna.org:hsa-miR-19a-5p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).