Accession | MIMAT0004486 |
Description | hsa-let-7f-1-3p mature miRNA |
Hairpins | |
Sequence | CUAUACAAUCUAUUGCCUUCCC |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27812761 | has_input UniProtKB:Q9UGV2 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27812761 | has_input UniProtKB:Q9UGV2 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|