Mature sequence ame-miR-100-5p

Accession numberMIMAT0004420
IDame-miR-100-5p
Stem-Loop ame-mir-100
Sequence
aacccguagauccgaacuugug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).