Mature sequence ame-let-7-5p

Accession numberMIMAT0004418
IDame-let-7-5p
Stem-Loop ame-let-7
Sequence
ugagguaguagguuguauagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).