Mature sequence ath-miR845b

Accession numberMIMAT0004317
IDath-miR845b
Stem-Loop ath-MIR845b
Sequence
ucgcucugauaccaaauugaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).