Mature sequence ath-miR836

Accession numberMIMAT0004257
IDath-miR836
Stem-Loop ath-MIR836
Sequence
uccuguguuuccuuugaugcgugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).