Mature sequence ath-miR834

Accession numberMIMAT0004254
IDath-miR834
Stem-Loop ath-MIR834
Sequence
ugguagcaguagcggugguaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).