Mature sequence cel-miR-789-3p

Accession numberMIMAT0004224
IDcel-miR-789-3p
Previous IDscel-miR-789
Stem-Loop cel-mir-789-1 cel-mir-789-2
Sequence
ucccugccugggucaccaauugu
Get sequence
Deep sequencing564 reads, 15 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2